MICROBIOLOGY 101 INTERNET TEXT

CHAPTER X: GENETIC ENGINEERING



 

Updated: 3/10/97


TABLE OF CONTENTS



 

INTRODUCTION

As previously discussed, we are in the middle of a biological informational revolution that will change our lives in ways we can only begin to imagine. Although Molecular biology and Genetic Engineering are perplexing to most people (e.g. the jurors on the O.J. trial) its basic principles are straight forward. The basic laboratory steps in GENETIC ENGINEERING (GE) are so simple that high school students routinely perform them. In this section of Micro 101 you will become acquainted with these principles, the fundamental steps of GE and some of the things that can be done using these procedures. The objectives of this section are to learn:

What the BASIC TOOLS of GE how are and how they work.

How GENE CLONING is carried out.

How DNA can be used to IDENTIFY all living organisms

How we can DETECT very TINY QUANTITIES of DNA even when they may be millions of years old.

In addition, ETHICAL problems of the GE revolution will be presented and some possible ways of dealing with them considered. 



 

DESCRIPTION OF MOLECULAR BIOLOGY

MOLECULAR BIOLOGY is the area of biology that is concerned with how biological molecules INTERACT with each other at the MOLECULAR LEVEL; a sort of ONE-ON-ONE SITUATION. To fully understand the PROCESSES OF LIFE it is necessary to understand what is occurring at the atomic/molecular level. Life is a matters of TINY interactions occurring at ATOMIC DISTANCES. Since we are currently unable to observe directly the molecular events taking place on an enzyme's or membrane's surface, or between a ribosome and mRNA etc., we must investigate these processes through indirect means. This is analogous to putting you in a dark room with a number of machines and asking you to figure out how they work together. However, there are scientific procedures in development that may eventually allow us to observe molecular processes while they are occurring within a cell (I hope I live long enough to "see" that!). A molecular biologist, which almost EVERYONE in biological science today calls themselves, uses a variety of SENSITIVE procedures to probe (examine) molecular interactions. These procedures involve using LABELS to follow molecules through the processes they undergo and to pinpoint their presence, location and amount within a cell. There are MACHINES, some of which are only a cm square, that can detect and quantitate INDIVIDUAL MOLECULES of protein , DNA or RNA within a few min. There are procedures that allow scientists to MAGNIFY, or amplify very small quantities of biological materials so that they can identify and study them. Techniques are currently available that allow us to CONTROL A CHANGE anywhere in the genetic code of a gene. These machines, techniques and reagents are expensive, the experimental procedures labor intensive and, because of the EXQUISITE SENSITIVITY of the techniques, prone to error. However, their prices are dropping and they are becoming more reliable.

I have listed some of the changes you may experience within your lifetime, indeed some within the next few years. With the sequencing of the ENTIRE HUMAN GENOME anticipated around the turn of the century, a whole new set of possibilities will be unlocked. Currently (Fall 1996) we have sequenced >10,000 of the ~100,000 human genes, and the rate of sequencing is accelerating as sequencing techniques are improved. About 3,000 human genetic diseases are currently known. This means that approximately 14% of newborns are afflicted with a "visible" genetic disease. This does not begin to include the genetic-based "tendencies" (to develop cancer, arthritis, TB, colds, asthma, flu etc.) and/or "conditions" which all of us have; what genetic conditions do you have? For example, I and my half brother suffer from a genetic condition called Celiac Sprue, which means that wheat protein (gluten) does bad things to the cells in our intestine and we can't eat pizza etc. However, we are FINE as long as we don't eat wheat products. Sprue is a common genetic "condition" that effects up to 25% of the Irish and lessor numbers of other ethnic groups. How many reading this are Irish? Some of you suffer allergies, nearsightedness, migraines, etc., all of which have their basis in your genome. Once the human genome is mapped we can not only identify the particular alleles each of us have, but we will eventually figure a way to replace "undesirable genes" with "good genes". 



 


CRITICAL THINKING QUESTION: How do we as individuals and a society define "good and bad" genes? For example, if it turns out that genes are at the basis of alcoholism or homosexuality or child molestation or manic depression, do we set out to "cure" people of these genes? If a "homosexual" gene is found, what would you do if you found a fetus of yours was carrying that gene? 



 


One current problem with the genetic revolution is that knowing which gene causes a disease condition and being able to identify the presence of that gene in a person, doesn't mean we UNDERSTAND the molecular biology of the disease process, thus we usually CAN'T PREVENT or CURE the disease caused by a defective gene. An example of this TERRIBLE DILEMMA is that a number of genes that predispose women to breast cancer have been discovered (and new ones are continually being found). This raises important ethical and personal considerations.

If a CURE or PREVENTION is not possible, should a woman be told she carries such a gene?

If a cure or prevention is NOT POSSIBLE, would you want to know you had a time-bomb ticking in you?

If a cure or prevention is not possible, would you consider having your BREASTS REMOVED to prevent getting the disease? If you decide to do this (and many women have), without any sign of cancer, should the Health Insurance Co. pay for the removal of a healthy breast because it is "elective" surgery?

Another weighty issue is: As we become able to screen for the presence of even more DEFECTIVE GENES, how should the information obtained be used? Consider the following questions carefully.

Should one's mate, boss, insurance Co., potential employer etc. have access to your genetic information? Can you think of situations where it would be logical and reasonable for others to have this information? How about the army? The CIA?

If you owned a life insurance Co. would you give your political donations to a congressperson who favored requiring potential policy holders to give this information to their insurance Co.

Who pays for the screening for disease-genes, the cost of which currently is high? Should I have to pay for your screening & vice versa?

What if you control the genetic information and you know that giving it out will lead to an abortion; what would you do?

What if you have access to the genetic information of someone your daughter/son, sister/brother etc. is going to marry and you don't think they've told them of a serious genetic "condition". Would you tell? Who owns your loyalty? What is ethical here?

A final reminder of anyone who is considering avoiding these problems; gene therapy trials are currently underway (but they're having problems working: TIME 10/9/95; Science 269:1050 [1995]), people are deciding to abort on the basic of the results of fetal genetic testing and the number of identified defective genes increases almost daily (and some of the ones they find will be ones you and I carry). 



 

HISTORY OF GENETIC ENGINEERING

By the early 1960s geneticists had a good basic picture of genetics. However, they did not have any way to obtain and study the genes themselves except through the laborious procedures of mating and testing mutants. These procedures take an immense amount of time, money and effort and yield disproportionately MEAGER RESULTS. Further, there were no techniques to examine the genes at a molecular level, yet unless this was done the ultimate questions could never be answered. Because of these problems older geneticists were leaving the field and younger, ambitious ones, were looking elsewhere for their creative outlet. Then, as so often happens in science, a series of TOTALLY UNRELATED SERENDIPITOUS DISCOVERIES were made which propelled the genetic revolution upon the world. It all started with a seemingly odd result obtained with some phage.

In the 1950s it had been noted that if one grew a particular bacteriophage on a particular bacterial mutant host strain (A) and then infected a bacterial mutant-strain (B), of the same species, with the phage A, the yield of phage from strain B was VERY LOW. However, if you took the few phage B that were produced and infected strain B with them, the phage yield was now NORMAL. Subsequently, in the 1960s, it was found that the phage DNA that grew on strain B had been CHEMICALLY MODIFIED so that it could not be cleaved (destroyed) by a DNase in strain B. The DNase involved in this cleavage was found to be somewhat specific, in that it mainly cut the DNA at CERTAIN SEQUENCES; unless these sequences had been CHEMICALLY MODIFIED by enzymes in the cell (missing in strain A). All previous DNases cut DNA randomly, so this finding suggested that DNA could be cut up into SPECIFIC FRAGMENTS which would ALWAYS contain the SAME SET OF GENES between the cut-sites. However, these first "specific" DNases did not prove as SPECIFIC as hoped. Finally, in 1970 Hamilton Smith accidentally found that a DNase from the bacterium, Haemophilus influenzae, CUT DNA ONLY at UNIQUE DNA SEQUENCES known as PALINDROMIC SITES



 

PALINDROMES

The term palindrome refers to groups of letters that form the same words when read both forward and backward. For example, "MADAM, I'M ADAM"; "ABLE WAS I ERE I SAW ELBA"; "DENNIS SINNED"; "MA IS A NUN, AS I AM"; "SEX AT NOON TAXES".  Click here for a URL site giving examples of many palindromes.
 



 


In DNA a PALINDROMIC SITE is a SEQUENCE OF BASE PAIRS in double stranded DNA that reads the same backwards and forward across the double strand. For example, the sequence of base pairs GAATTC is a palindrome because both sequences of the double strand READ THE SAME when read from either their respective "G" or "C" ends (COMPLEMENTARY strand = CTTAAG). The enzymes that cut these specific sites are calledRESTRICTION ENZYMES (RE). Based on the TYPES OF CUTS they make, there are two types of RE:

One group cuts straight across the double stranded DNA, producing BLUNT ENDED DNA (Fig. 2).

Another type cuts the strand of DNA OFF THE CENTER of the palindromic sites, but between the SAME TWO BASES on the opposite strands. This leaves one or more bases overhanging on each strand and such ends are called STICKY ENDS (Fig. 1) because they form HYDROGEN BONDS with their complementary cut counterparts.

For example, in the base sequence GAATTC, the RE that cuts this site cleaves the DNA between the "G" and the "A" on each complementary strand, thus leaving the overhangs of AATT & TTAA respectively (Fig. 1). Over 200 different RE have been isolated that cut at many different specific DNA sequences. They are all QUITE SPECIFIC and this specificity is the KEY to their use. REs that cut at 4, 5, 6, 8, 9, and 11 base pair palindromic sites have been found. It follows that the MORE BASE PAIRS in the palindromic site the LESS LIKELY a site is to exist statistically. That is, a 4-base-cutting RE cuts the same DNA many more times than an 8-base-cutter does. The odd numbered cutting sites are not true DNA palindromes, in that the central bp reads different in the two directions. For example AA?TT is a 5 bp cutting site, where the ? = a number of different bases.
 


Figure 1. Sticky ended cut with restriction enzyme. The red arrows indicate the positions where the RE cuts the DNA. When the complementary stands pull away the "sticky end" overhangs are left.

Figure 2. Blunt ended cuts by a restriction enzyme. Blunt end cutting REs cleave the DNA between two bases in the middle of a palindromic site. 


CRITICAL THINKING QUESTION: The following are examples of RE DNA sites on a single strand. Add the complementary bases and find the RE sites: CCTAGT; AATCCTAGGACG; AAATTAATCGG; TAAGGCGCGCCTAAT; TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTATCCCCGGGTACCGAGCTCGAATTCACT.

There are 10 RE sites in this last one, can you find all ten? 



 


The final important component in genetic engineering is an enzyme called LIGASE. Ligase is an enzyme that covalently joins the sugar-phosphate backbone of bases together. Ligase is also involved in DNA replication. In effect LIGASE reverses the action of the RE, which breaks the sugar-phosphate backbone-bonds. Ligase requires energy to form these bonds (Fig. 3). Ligase will join either "sticky" ends or "blunt" ends, but it is more efficient at closing sticky ends because the "sticky overhangs" of these ends adds stability which holds the stands together while the ligase works, whereas the blunt ends are LESS STABLE. The sticky ends must have the SAME "base overhang" (Fig. 1), but ANY BLUNT END can be joined to any other blunt end (Fig. 2).
 


Figure 3. The ligase reaction. The sticky ends of two DNA strands line up according to their bp hydrogen bonding. The cut sites are indicated by the blue arrows. The ligase binds to the hydrogen-bonded DNA strands and forms covalent bonds between the two DNA ends (red bonds), thus joining them. Similarly, if the blunt ends of DNA come together the ligase can form covalent bonds between them.


 


Review of the components of GE:

(1) Double-stranded DNA contain palindromic restriction enzyme sites.

(2) Many types of restriction enzymes cut or cleave palindromic sites in the double-stranded DNA sample forming either a sticky or a blunt end.

(3) The enzyme ligase plus an energy source fuses or join two sticky or two blunt ends of DNA together. 



 

THE STEPS IN GENETIC ENGINEERING

In GE the idea is to move a "GENE OF INTEREST" from its original or SOURCE DNA molecule into another or TARGET DNA molecule for some SPECIFIC PURPOSE. Those of you who are computer aficionados will note the similarity in terminology in describing the moving of computer files. We will discuss the various purposes later. The process of moving a gene from one DNA molecule to another DNA molecule is called CLONING. In the cloning process a fragment of DNA, containing a gene- or sequence-of-interest, is CLONED (moved) INTO A VECTOR where it can subsequently be grown (COPIED) in large quantities and MANIPULATED in a variety of ways. The most common vectors are bacterial PLASMIDS, but viruses and self-replicating units in eukaryotic cells are also employed as vectors. The process of cloning is straight forward and only requires the following four steps and can be done in a couple of hours or less.

Isolating the SOURCE and VECTOR DNA. The DNAs must be relatively free of contaminating materials which interfere with the subsequent enzymatic steps.

Both the source and vector DNAs are cut with RESTRICTION ENZYMES. When sticky ends are formed the DNA is cut with the same restriction enzyme(s), but RE that produce blunts ends also work well in cloning.

The vector and source DNAs are mixed with a LIGASE SYSTEM and covalently bond together.

Finally, the LIGATED DNA is TRANSFORMED into a host cell. Usually the host cell is a COMPETENT bacterium, but increasingly eukaryotic cells are being used. After suitable growth has occurred the host cells are examined for the PRESENCE of the source or CLONED DNA in its cytoplasm.

The entire cloning process often takes LESS THAN A DAY and is carried out using volumes of 1,000 microliters or less. The examination of the transformed host for the gene-of-interest may take an additional day or so. A gene which has been successfully transferred in this way is said to have been CLONED. The process is referred to as "CLONING", "RECOMBINANT DNA TECHNOLOGY", or "RECOMBINANT DNA". These steps are summarized in the figure 4 below.
 


Figure 4. Cloning. For another figure illustrating cloning click here and view Fig. 11a. 


USES OF CLONED DNA.

To do molecular biology on a single gene it is necessary to ISOLATE it from all the other genes. This is not always easy considering that an average bacterium contains 1,000 to 4,000 genes, while eukaryotic cells may contain >100,000 genes. A cloned gene can be AMPLIFIED by making many COPIES of the clone so as to produce large enough quantities to study it in detail. The usual things that are done to an amplified gene are:

SEQUENCING: Sequencing determines the base pair sequence of a gene. By reading the 3-letter code, sequencing also describes the AMINO ACID SEQUENCE translated from that gene.

MUTATION: The gene bp sequence can be changed in specific ways and the modified gene can be inserted back into its original host to see what each specific mutation does. Whereas, spontaneous mutation is random, techniques are now available that make it possible to CHANGE any codon within a gene to any other codon. Therefore, it is possible to study the effects of SINGLE AMINO ACID CHANGES on the function of the gene product, which is, after all, the ultimate purpose of the exercise.

To replace a mutated form of the gene in the original host cell with a healthy form of the gene to see exactly what it does in its intended place of residence.

To use the amplified gene to make HUMONGOUS QUANTITIES of the GENE PRODUCT for commercial purposes. This is how products like human insulin, human growth hormone, plasminogen activator, interlukins and the bovine milk hormone are all produced.

To INSERT the gene into ANOTHER SPECIES for some purpose. Such animals or plants are said to be TRANSGENIC. For example, many crops are protected against caterpillar larvae because a gene from a bacterium has been inserted into their cells. This gene produces a protein that is HIGHLY, and SPECIFICALLY, TOXIC to the larvae of many moths and butterflies that attack food crops. 



 

TRANSGENIC ORGANISMS

Transgenic means "ACROSS SPECIES". The above techniques give us the ability to move viral genes into humans, human genes into plants, plant genes into viruses etc. etc. There is (SPRING 96) a flood of transgenic plants in the approval pipeline; two types of transgenic tomatoes are in our local supermarkets, transgenic squash are coming soon and a number of transgenic crops are currently protected from insect larvae by the protein described above. Click here to read about a problem occurring with this process.

There is a DOWN SIDE of GE. The same procedures that can be used to produce a better crop, or human insulin, can also be employed to make a more POWERFUL PATHOGEN. There is evidence that some countries have or are considering doing this. For example, Iraq was apparently growing bacterial pathogens for biological warfare, but it was deterred from using them when we threatened atomic retaliation. It is only a small jump in "reasoning" to consider engineering a "better pathogen" with which to destroy a hated enemy (fill in blank--the news report that some Americans. consider anyone working for the government to be the enemy). For more information read "The spectra of biological weapons" Scientific Am. Dec. 1996, pg. 60.
 


Figure 5. The use of gene cloning to amplify the cloned DNA and/or to produce lots of the cloned gene's product. 


CRITICAL THINKING QUESTION: What should we do about regulating genetically engineered plants and animals? Should we require that they be tested for safety, that they be labeled as GE? Can you think of any other considerations regarding these "products"? Will you eat "genetically engineered foods"? 


DNA FINGERPRINTING

You will view the video Murder, Rape and DNA in lab and questions on it may appear in subsequent exams. Throughout the "year(s) of O.J." we have heard about DNA testing and its role as evidence. It remains to be determined whether the jury understood the DNA evidence and ignored it, understood it, but felt the evidence was planted by the police, or simply didn't understand it and IGNORED it. I must admit to being sent off to yawn land by the hours of testimony (which I only watched because of my scientific interest, of course).

The THREE basic principles required to understand DNA fingerprinting and all that follows from it you already know (the principle of ligand/receptor binding; see fig.2 chap 7), but it is worth taking a moment to review them.

BASE-PAIRING of AT (AU) & GC is the BASIC PRINCIPLE of this procedure. If you understand this all else fall easily into place.

SPECIFICITY of enzyme activity is the second CRUCIAL principle to understanding DNA fingerprinting. This refers to the cutting of DNA by specific RESTRICTION ENZYMES at UNIQUE palindromic sequences.

The recognition that a CHANGE in a SINGLE BASE PAIR (a mutation) can either MAKE a RE-site where one did not exist previously or it can REMOVE or ELIMINATE a RE site from a gene. An analogy would be to "mutate" your phone number by one letter; callers would get a different person.

To understand DNA fingerprinting the double stranded DNA molecule must be viewed as a chain with RANDOM RESTRICTION ENZYMES-sites (palindromes) located along its length. If each of these various unique restriction sites were marked with a different color, the DNA would appear as a random multicolored stripped ribbon. If one set of unique restriction enzyme sites were colored RED and the appropriate RED-restriction enzyme added, the DNA would be CLEAVED into a series of VARIOUS SIZED FRAGMENTS depending on where the RED-SITES were located along the DNA molecule (Fig. 6). It is easy to understand that the group of DIFFERENT SIZED FRAGMENTS would be UNIQUE for two DNA strands with the RED-restriction sites located at DIFFERENT PLACES along their respective DNA double strands. The addition of a GREEN-restriction enzyme that cut GREEN-SITES would produce a different group of sized fragments. Each of these groups of restriction enzyme-produced fragments would represent a unique FINGERPRINT of that DNA (Fig. 6).
 


Figure 6. In this FIGURE there are two genes with the palindromic sites for two different restriction enzymes MARKED AS GREEN OR RED BARS. The number and size of the DNA fragments that would result if the DNA containing these two genes were cut with the respective restriction enzymes are shown. Determine the pattern you would get if you cut this DNA with BOTH ENZYMES at the SAME TIME; lay it out from the smallest to the largest fragment.


 


The DNA fragments are visualized using the technique known as GEL ELECTROPHORESIS, which you performed in lab exercise 15. Briefly, porous gels composed either of a PLASTIC called ACRYLAMIDE or of a derivative of agar, called AGAROSE, are used to separate DNA fragments based on size. The gels are prepared with wells into which the DNA fragments are ADDED. The gels are submerged, under an electrolyte buffer solution between a positive and a negative electrode; the DNA-containing solutions are added to the wells and the current is turned on. The DNA fragments are NEGATIVELY CHARGED so the wells containing them are placed closest to the negative electrode. When the current is turned on the DNA moves through the pores in the gel TOWARDS THE POSITIVE ELECTRODE. The shorter fragments move FASTEST because they are able to navigate through the pores of the gel more easily, whereas the longer DNA fragments move PROPORTIONALLY MORE SLOWLY through the pores. The result is a separation of the DNA fragments based on their length (SIZE). The DNAs are stained by dyes that binds to the DNA and fluoresces strongly when exposed to UV-light. The various sized DNA fragments appears as a series of bands that resemble a BAR CODE. See Fig. 13



 

MUTATIONS & DNA-FINGERPRINTING

DNA fingerprinting works because of mutations which CHANGE THE GENETIC CODE, randomly MAKING and ELIMINATING restriction enzyme sites randomly throughout the DNA. Because of these variation in genes between individuals the likelihood that the restriction enzyme fragment pattern of two individuals BEING THE SAME is very very small unless they are IDENTICAL TWINS. To determine a DNA fingerprint a small amount of DNA-containing material from an organism is required. This could be obtained from any tiny quantity of tissue or blood, even the material from a single hair follicle is sufficient. The variation in the gel fragments from different DNAs from members of the SAME SPECIES is called RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS (RFLP).

In Figure 7 the gel pattern of a hypothetical analysis of O.J.'s DNA vs. a sample of unknown DNA is depicted. The two isolated DNAs were treated with the same RE and the fragments separated on an agarose gel. Two unique restriction enzyme fragment patterns are seen. The conclusion is that the blood samples came from DIFFERENT INDIVIDUALS. The SOURCE of the DNAs clearly influences the significance of these results. For example, if the two samples were collected at the scene of the crime it would mean one thing, but if the unknown DNA sample came from O.J.'s shirt and it matched that of one of the victims at the scene of the crime, the data takes on more significance.
 


Figure 7. Clearly the DNA from the scene-of-the-crime is not that of O.J., as the fragment patterns (the DNA fingerprint) are different. Had they been the same what would that of said about the innocence or guilt of O.J.? 


HYBRIDIZATION

FAQ: "If the genome of humans contains so many genes it must have thousands of R.E. sites which would produce thousands of bands which would be very difficult to RESOLVE INTO INDIVIDUAL BANDS in a small gel wouldn't it?"

ANSWER: This is exactly what happens. When genomic DNA is treated with a RE and separated on a gel, what is seen is a continuous smear composed of 1,000s of individual DNA fragments. This problem is solved by a technique known as HYBRIDIZATION.

Hybridization again depends on the basic principle of HYDROGEN BONDING between GC & AT bonds in nucleic acids. The principles in the hybridization steps are:

DNA strands are SEPARATED by breaking the hydrogen bonds between the bases with heat to produce SINGLE STRANDS.

Strand separation is STRICTLY DEPENDENT up on two factors: The TEMPERATURE (amount of heat energy) and the NUMBER of hydrogen bonds (an incorrect base pairing does NOT form H-bonds).

When the temperature drops, single DNA strands in the same solution that are complementary SPONTANEOUSLY COME TOGETHER by pairing up through their respective AT & GC associations. The strength of their subsequent association depends on the temperature and the total number of MATCHING base pairs.

The TEST or SAMPLE DNA is usually FIXED or BOUND to a solid surface in a SINGLE-STRANDED STATE. A piece of DNA of KNOWN SEQUENCE to which something is attached that can be DETECTED or SEEN is then mixed with the bound DNA and the two are incubated together under conditions that will allow COMPLEMENTARY DNA sequences to join through the appropriate hydrogen bonding. The DNA molecule which can be detected is called a PROBE.
 


Figure 8. Hybridization probe. A short piece of DNA of known sequence (black bases) has a REPORTER substance attached to it. This reporter is usually a radioactive element like phosphorous-32 or an enzyme that induces light production from a substrate molecule and is indicated in this figure by the light bulb. If the probe sequence finds a complementary base sequence on the bound target or sample DNA, it will hydrogen-bond to it. When the excess, unbound probe is washed away the location of the bound probe and its complementary DNA can be detected by the REPORTER on the probe.


 


That is, the MORE hydrogen bonds there are the HIGHER the temperature must be to completely SEPARATE two DNA strands and to keep them separated. For example, if there were two stands of DNA composed of 200 PERFECTLY complemented base pairs, then it would take a temperature of 58oC. to separate them. However, if only 199 of the base pairs were correct, it would only take 57oC. to separate them; if there were only 100 correct base pairs the DNA strands would fall apart at ~29oC; i.e., fewer bonds require less heat (energy = lower temperatures) to rupture them.
 


Figure 9. In this figure a short piece of DNA, called the PROBE (Pink Star) is mixed with two different long DNA strands. One of these long strands contains a sequence of bp that exactly matches that of the probe, whereas the other differs with respect to a single bp (yellow oval). At 55oC the probe binds to BOTH long DNA molecules, however at 65oC the probe does not bind to the long DNA molecule with a single base pair mismatch. The probe is unable to bind to either long DNA molecule at 90oC. What do you think might be the results at a temperature of 60oC? 



 


Hybridization is carried out as illustrated in Fig. 10:

  1. The isolated DNA is FRAGMENTED (CUT) with restriction enzymes.
  2. The cut-DNA is separated into fragments according to SIZE on a gel.
  3. The DNA fragments are transferred, IN POSITION, to a membrane to which they TIGHTLY BIND.
  4. The membrane-bound-DNA is soaked in a solution containing PROBE-DNA that is labeled with something that can be DETECTED (seen by the eye).
  5. The membrane-bound-DNA-probe mixture is incubated at a temperature designed so that ONLY THE PROBE DNA strands that have a high degree of COMPLEMENTARITY (base pair matching) to DNA strands bound to the membrane will be able to bind (Hydrogen-bond) to each other.
  6. The unbound probe is washed away and the position of the bound probe is determined using its detection system of the probe.

Figure 10. The hybridization procedure.


 


The entire procedure is called HYBRIDIZATION. Hybridization works because of the SEQUENCE OF THE PROBE. A given probe will only bind with DNA that is attached to the membrane IF IT FINDS a MATCHING or COMPLEMENTARY DNA base pair sequence that forms enough bonds to remain together under the heating conditions used. Thus if no matching complementary sequences are found, NO PROBE will bind (Fig. 10, green DNA). If one or two of the 1,000s of the bound DNA fragments contain a sequence complementary to the sequence in the probe, the probe will BIND only to these fragments and thus become ATTACHED TO THE MEMBRANE through this association with the complementary membrane-bound-DNA (Fig. 10, red DNA). It is possible to chose probes that are known to bind to specific sequences or artificial probes of KNOWN SEQUENCES can be made, for about $1.00/base and sent to you in 48 hr.; THEY CAN BE ORDERED OVER THE INTERNET.
 


Figure 11. The original gel, shown in the middle, produces a smear of genomic DNA fragments (see Fig. 13). Within those 1000,s of fragments are the fragments shown on the left gel cut from a section of the two original DNA molecules shown in the upper left. When the smear of fragments, fixed to a membrane, are hybridized with the probe (DNA with attached reporter [green star], Fig. 8), the probe will HYBRIDIZE (bind) only to those fragments containing sequences of DNA that complement sequences present in the probe; i.e., those regions DIRECTLY BELOW the probe DNA. The location (pink ovals) of such complementary membrane-bound-fragments are shown on the gel at the right. Thus the detection system only "SEES" the pink ovals. See Fig. 13 for X-ray film detection of DNA fragments from a genomic DNA smear.

Figure 12. Homework project.


 


In Fig. 12 three different PROBES (A, B, & C) are hybridized against the separated membrane-bound-DNA fragments shown on the right (from 3 duplicate gels). As an exercise determine WHICH BANDS each of the three probes will hybridize (bind) to; that is, draw three duplicate gels, 1, 2, & 3 and circle the band(s) in gel 1 that probe A will bind to; in gels 2 & 3 do the same with probes B & C respectively.
 


Figure 13. These are three experimental gels showing the outcome of a hybridization procedure. Gel A shows the banding pattern seen when genomic DNA, digested with a restriction enzyme, is separated on an agarose gel. The smears in lanes 1 to 9 represent 1,000s of individual DNA fragments produced by the restriction enzyme digestion. The banding seen in these lanes is due to the high concentration of certain genes. Gels B & C show examples of banding patterns obtained when genomic DNA smears, bound to a membrane, are hybridized with specific probes. The probes only bind, or hybridized to, a few of the 1,000s of fragments that contained base sequences COMPLEMENTARY to those on the probe. Attached to the probes is substance which produces LIGHT when treated with certain chemicals and this light is detected with photographic film, in effect taking a picture of each of the locations where the probes bind to a complementary DNA fragment on the membrane.  click here and then click on "Hybridization" for some other cartoons of Southern Blotting and illustrations of other molecular biology techniques. 



 


Figure 14 illustrates how the blood from O.J.'s trial was tested to determine matches. The DNA from the various samples of blood (from the gloves, the Bronco, the socks, the bodies etc.) was extracted, digested with one or more restriction enzymes, separated on gels, transferred to DNA-binding membranes and hybridized with various probes. The pattern of the DNA fragments (bands) from the samples that "lights up" were then compared for similarities and differences.
 


Figure 14.


 


FAQ: About DNA fingerprinting.

1 How good (accurate) is it at identification. For example, is it as good as classical fingerprints?

Answer: In theory, with the exception of identical twins, EVERYONE on this planet has a different DNA fingerprint. That is, DNA fingerprinting IS as good (distinctive) as classical fingerprinting for identification.

2. What are its advantages?

Answer: In theory DNA fingerprinting will work with much smaller amounts of material than a classical fingerprint & DNA lasts much longer than classical fingerprints. DNA-containing samples that are many years old (up to 25 million yr.) are still usable. Only very tiny quantities of DNA are required in order to carry out a highly accurate test. For example, dried blood, semen, spit, skin etc. on samples stored in dusty files for years are still usable. Samples of mixed DNA's can also be used. DNA containing evidence is much harder to clean up at a crime scene than other evidence, like classical fingerprints.

3. What are its limitations?

Answer: There currently are no accepted Federal standards for controlling the quality of DNA testing nationwide. Poor quality & poorly controlled testing leads to QUESTIONABLE and SHODDY RESULTS. Lab A may use one set of procedures and standards, whereas, lab B may use another set of procedures and standards. Making comparisons between results from the two labs difficult. The quality of laboratory personal is not standardized. For example, clinical laboratory technicians, that work in hospitals and clinical labs, must be certified by their states and by a national organization that sets high standards of training and experience. The clinical labs are frequently tested to determine if their procedures are done correctly. They receive & must analyze test samples whose composition is known by certification agencies. The results are returned to the certification agencies for evaluation. If a clinical lab makes too many errors the lab will be DECERTIFIED. This is not yet the case with DNA testing facilities.
 


Do you think there should be a set of national standards for DNA testing or should each state set their own standards?


 


Even if there is a perfect match between DNAs, you can not say HOW the DNA containing sample got there or WHEN. In the O.J. trial a VALID question was raised about the possibility of evidence being planted. What makes this charge so powerful is the EXTREME SENSITIVITY of the procedure. That is, it would NOT BE DIFFICULT for someone to collect a small quantity of blood (one or two drops from a tube of a blood sample), body fluid or tissue from a victim (e.g. hair in a comb, blood on a Kleenex etc. ) and place this material where it would incriminate an innocent person. There are documented cases where quantities of drugs, marked money etc. have been "planted" and innocent people convicted of crimes because of these actions.

Finally, blood that is mixed with the wrong chemicals or is degraded is difficult to analyze accurately.

4. When faced with DNA evidence what questions should be asked?

Answer: As indicated above (and in the O.J. trial), questions regarding the handling of the evidence, the quality of the testing, including the quality controls used, the skill of the testing personnel, the accuracy of the data interpretation, possible contamination of the evidence, the possibility of accidental, or intentional misplacement of evidence are all valid questions that should be raised regarding DNA evidence (or any evidence for that matter). As the sensitivity of this powerful technique improves and its use widens throughout our justice system, it is important that we deal with these problems if we expect EQUAL JUSTICE for all. We must not lose sight of the fact that no matter how powerful a new tool in crime fighting is, its ultimate effectiveness is only as good as the persons using that tool



 


Do you think O.J. did it and if so, how would you have voted based only on the evidence had you been a jury member? 


POLYMERASE CHAIN REACTION

The polymerase chain reaction (PCR) won its discoverer a Nobel Prize in 1993. Karry Mullis has recorded the thought process he went through as he conceived of the idea and he states that he knew immediately that he was going to become very "FAMOUS" because of this discovery. Everyone else guessed that he would win the Nobel Prize as soon as they heard of the PCR reaction. The ironic thing about this discovery, is that all the scientific information had been around for approximately 20 years and had been overlooked by the greatest scientific minds in the world. This discovery is now seen as such an obvious concept that some scientists question if Mullis deserved the Nobel Prize for such a "simple" and "obvious" discovery. After you hear the PCR story you can make up your own mind?

The PCR is another one of these discoveries, like that of the structure of DNA, the transforming factor determining the chemical nature of DNA, and restriction enzymes, that generated a quantum leap in science. Almost the instant after PCR is explained to a biological scientist, ideas as to its uses begin to pour from all but the most dull scientific mind. Even today, years after its discovery, we are still developing new uses for PCR.

The irony of the PCR is that living organisms have been doing it since they evolved in the primeval organic soup of this planet 3.5 billion years ago and scientists have been aware of the general DETAILS of this process for ~50 years. To put it succinctly, the PCR does in the test tube what every bacterium does in its tube of media or on an agar-plate and each of us do every day; we all produce billions of exact copies of our own DNA; AMPLIFYING our DNA millions of time. The enzyme DNA polymerase was discovered in the 1950s and our knowledge of the process has been increasing ever since. This means that thousands of scientists have studied DNA replication for 40 years without tumbling to PCR.

The basic principle of PCR is shown in Fig. 15. It has been know for a long time that DNA polymerase requires a short stand of DNA or RNA called a PRIMER to "prime" the START OF DNA REPLICATION. Mullis's genius was that he reasoned "That if you added the following components to a test tube containing a single DNA molecule, you could replicate & amplify that DNA molecule many million fold in a short time.

The components are:

A sample of the TARGET DNA to be copied. In theory only a single molecule is needed.

A set of short (15 to 40 bases) single stranded PRIMERS of DNA, in EXCESS, that will bind to complementary regions of the opposing stands of the TARGET DNA molecule . These primers BRACKET the region of DNA to be amplified.

An EXCESS of the 4 nucleotide triphosphates, ATP, GTP, CTP, TTP.

The enzyme, DNA polymerase.

Various buffers and cofactors like magnesium ions required by DNA polymerase.

The final trick was to get the two target DNA stands APART (separated) so the primers could bind and the DNA polymerase could do its thing. It had been known for ~50 years that heat separates DNA stands and that complementary strands then rejoin through base pairing when the temperature is subsequently lowered. So Mullis heated his mixture of target DNA, primers and triphosphate nucleotides to about 90oC for a few minutes to separate the target DNA. He then lowered the temperature enough to allow the primers, which were small and in VAST EXCESS, to bind (ANNEAL) to their respective complementary target DNA bp-sequences. At this point he added DNA polymerase and allowed the polymerization reaction with the triphosphate nucleotides to occur. That is, the DNA polymerase FILLED IN the missing portion of each strand making TWO NEW DOUBLE STRANDED regions of DNA.
 


Figure 15. The polymerase chain reaction. For another figure illustrating the PCR  click here and view the "PCR" link.


 


Each entire PCR cycle takes only 2 to 10 minutes. However, there was one problem with the system devised by K. Mullis, which was that the DNA polymerase he used was DESTROYED BY THE HEATING process. Mullis had to add new DNA polymerase for EACH ROUND, which was time-consuming and expensive. This problem was solved by using HEAT-RESISTANT DNA polymerase that only needed to be added once. THERMOPHILIC bacteria that live in boiling hot springs have been described previously. This is another case of SERENDIPITOUS BASIC SCIENCE turning out to be important. The study of thermophiles might seem to be a waste of money and time to many people as these bacteria, while certainly interesting, don't cause disease in man or any other life form. The argument could be made that a scientist could better spend his/her time working on cancer or some other terrible disease that afflicts humankind. However, it turns out that since thermophilic DNA polymerases tolerate high temperatures (e.g. 90oC) for long periods without being destroyed, they are the perfect solution to the PCR DNA polymerase problem. Thus today PCR has become a revolutionary tool because of scientists who studied these odd thermophiles.
 


Figure 16. This figure represents another perspective of the PCR reaction. Of particular note is the use of the PCR to AMPLIFY SPECIFIC DNA SEGMENTS dependent on the PRIMERS EMPLOYED. By choosing primers with unique sequences one BRACKETS a known length (gene[s])of a DNA molecule. The bracketed segment is indicated by the dashed lines. The red and blue primers, by their COMPLEMENTARY BINDING to bp-sequences on the two respective parental DNA strands insure that ONLY the portion of DNA between them will be amplified. Five cycles of replication are shown, except that the last cycle is incomplete. Note that the number of DNA molecules increases EXPONENTIALLY with each cycle of replication.


 


The standard PCR reaction is run through about 30 cycles in a couple of hours which results in the amplification of the original DNA by over a 109 fold. Thus a single specific DNA region can be amplified to yield sufficient quantities to do anything that can be done with bulk-isolated DNA. In the case of crime evidence this means that the DNA in a single hair follicle, a single drop of semen or blood is sufficient to prove that an individual was present at the scene of a crime. Indeed any piece of evidence that contains one or more moderately long DNA fragments (e.g. >200 base pairs) can be amplified with PCR and its RFLP determined for identification purposes---or maybe to build a dinosaur eventually. However, at present the maximum limit for amplification is approximately 42 kilobases. 



 

SUMMARY OF DNA FINGERPRINTING

DNA fingerprinting is a powerful technique that is capable of distinguishing every individual organism from every other individual organism on this planet with the EXCEPTION of identical twins or clones.

The major limitations of DNA fingerprinting are human error and the quality of the technology used.

The discovery of PCR increased the sensitivity and versatility of DNA fingerprinting, and changed the face of molecular biology.

These techniques will allow infectious diseases to be identified within hours or even minutes. They are accelerating the rate of sequencing the human genome, they allow the investigation of complex ecological interactions and species relationships that here-to-fore have been too complex to study.
 


WELCOME TO THE NEW WORLD OF GENETIC ENGINEERING; JUST KEEP YOUR SEAT BELTS FASTENED BECAUSE IT IS GOING TO BE A WILD RIDE.



 

Copyright © Dr. R. E. Hurlbert, 1996. This material may be used for educational purposes only and may not be duplicated for commercial purposes.